circad | circRNAs associated with diseases

circ_004077
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Pancreatic Cancer	ICD-10	Malignant neoplasm of Pancreas, unspecified (C25.9)
DBLink		PMID	29781033
Experimental Method
Sample Type	Tissue and cell lines	Comparison	The PC cell line, SW1990
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AAGATCCCGGATGACATGAG Reverse GAGTCTTGGGAGGGTTGTCA	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Xu, C, Yu, Y, Ding, F (2018). Microarray analysis of circular RNA expression profiles associated with gemcitabine resistance in pancreatic cancer cells. Oncol. Rep., 40, 1:395-404.